علوم زيستي ورزشي _ بهار 1395 دورة8، شمارة 1، ص : 65 – 75 تاريخ دريافت : 19 / 09 / 92 تاريخ پذيرش : 20 / 07 / 93

تأثير 14 هفته فعاليت استقامتي بر بيان miR-1 بطن چپ رتهاي نر نژاد ويستار

محمد فتحي 1– رضا قراخانلو 2- حميد رجبي3
1. استاديار فيزيولوژي ورزش گروه تربيت بدني، دانشگاه لرستان، خرم آباد، ايران 2. دانشيار، گروه تربيت بدني، دانشكدة علوم انساني دانشگاه تربيت مدرس، تهران، ايران 3. دانشيار، دانشكدة تربيت بدني و علوم ورزشي،
دانشگاه خوارزمي، كرج، ايران

چكيده
miR-1 در بسياري از فرايندهاي سلولي از جمله هايپرتروفي بافت عضلاني (اسكلتي و قلبي) درگير است. فعاليت هاي استقامتي نيز موجب هايپرتروفي قلب مي شود، بنابراين هدف اين مطالعه بررسي اثر فعاليت استقامتي بر بيان miR-1 قلب است. بدين منظور 14 رت در شرايط كنترل شده (دما، چرخة روشنايي و تاريكي و دسترسي آزاد به آب و غذا) نگهداري شدند و بعد از آشناسازي با پروتكل تمريني بهصورت تصادفي در دو گروه كنترل و تجربي قرار گرفتند. گروه تجربي يك برنامة (14 هفته اي) استقامتي را روي تردميل اجرا كرد. در ادامه 48 ساعت پس از پايان آخرين جلسة تمريني بي هوش و تشريح شدند، سپس قلب و بطن چپ آنها خارج و با استفاده از روش Real time-PCR ميزان بيان miR-1 قلب آنها اندازه گيري شد. در پايان با استفاده از آزمون آماري t اطلاعات به دست آمده ارزيابي شد. نتايج نشان داد كه تفاوت معناداري در ميانگين بيان miR-1 قلب گروه كنترل و تجربي وجود ندارد (191.P=). فعاليت استقامتي بر بيان miR-1 قلب تأثير معناداري نداشت، احتمال دارد تغييرات miR-1 هرچند كم، در سطح پروتئين ژن هاي هدف آن مشخص شود.

واژه هاي كليدي
بطن چپ، فعاليت استقامتي، قلب، miR-1.
مقدمه
در پاسخ به محرك هاي گوناگون بافت عضلاني دچار تجديد ساختار مي شود (20)، بافت قلب از اين قاعده مستثنا نيست. از جمله محرك هاي تأثيرگذار بر بافت قلب، تحرك و بي تحركي است كه در پاسخ به اين عوامل، قلب به ترتيب دچار هايپرتروفي و آتروفي مي شود (8، 4). نكتة جالب تر اينكه پاسخ قلب به نوع تحرك نيز اختصاصي است، كه نشان دهندة دقت و ظرافت پاسخ هاي سلولي-مولكولي به فعاليت هاي بدني است كه در حقيقت ساختار قلب را با مسئوليت هاي عملكردي آن هماهنگ مي كند.
درحالي كه فعاليت هاي مقاومتي به افزايش ضخامت ديواره هاي قلب بدون تأثير شايان توجهي در حجم هاي داخلي آن در مدل هاي انساني و حيواني منجر مي شود، فعاليت هاي استقامتي اغلب موجب افزايش حجم هاي داخلي و همچنين افزايش ديواره هاي قلب مي شود، هرچند اين افزايش ديواره ها به اندازه اي نيست كه در فعاليت هاي مقاومتي رخ مي دهد (29، 19). اما اين موضوع نشان مي دهد كه پاسخ و سازگاري قلب به محرك هاي گوناگون بسيار كارامد است.
در سالهاي اخير RNAهاي غيركدي به نام microRNAها (miRs) كشف و مشخص شده است كه بيان ژن را در سطح پس رونويسي تنظيم مي كنند (28، 1)، به همين دليل اين عناصر پاسخ هاي بافتي را به طور دقيق كنترل مي كنند (13). همچنين اين عناصر در بسياري از فرآيندهاي سلولي درگيرند (28). برخي از miRs تنها در بافت عضلاني بيان مي شود، به همين دليل آنها را myomiR مي نامند
(28). از جملة اين myomiR مي توان به miR-1 اشاره كرد كه در شماري از فرآيندهاي عضلاني درگير است (28)؛ مشخص شده است در عضلة قلب همراه با miR-133 در تكثير و تمايز سلول ها در دوران جنيني قلب نقش دارد (10). miR-1 با تنظيم فعاليت HDAC4 (فاكتوري كه موجب فشردگي كروماتين مي شود) (10)، Hand2 (فاكتور رونويسي كه براي رشد قلب ضروري است) (32) و Irx5 (تنظيم كنندة رپلاريزاسيون قلب) (3) به ترتيب تمايز سلول هاي قلب، رشد بطني و هدايت پذيري قلب را تعديل مي كند (28).
پژوهش ها نشان داده اند كه فعاليت هاي بدني (استقامتي و مقاومتي) بر بيان miRs و myomiRs حداقل در عضلات اسكلتي اثر مي گذارد. براي مثال مك كارتي و همكاران (2007) نشان دادند كه miR-1 و miR-133 در پاسخ به يك دوره اضافهبار عملكردي در عضلات نعلي و پلانتاريس كاهش مي يابد، درحال يكه miR-206 بهطور معناداري افزايش م ييابد (15). در پژوهشي ديگر گزارش شد كه يك جلسه تمرين استقامتي موجب افزايش بيان معنادار miR-1 و miR-108 عضلات تمرين كرده مي شود (22). در پژوهش هاي نيلسن (2010)، مك كارتي (2007)، درآموند (2008)، ديويدسن (2011) (17، 15، 6، 5) و قراخانلو (منتشرنشده) تأثيرپذيري miRs از فعاليت بدني تأييد شده است. اما در بافت عضلة قلب تنها پژوهش سوسي (2011) نشان داد موش هايي كه 2 نوع پروتكل تمرين استقامتي كم شدت (10 هفته شنا، 5 روز در هفته به مدت يك ساعت) و كم شدت بلندمدت (همان پروتكل كمشدت تا هفتة هشتم، از هفتة نهم به بعد دو جلسه در روز و از هفتة دهم به بعد 3 جلسه در روز تمرين كردند) را اجرا كردند، ميزان بيان miR-1 و miR-133 در عضلة قلب در اثر هر دو پروتكل تمرين، كاهش يافت. هرچند تفاوت معناداري در بيان miR-1 و331- در زمانهاي متفاوت تمريني مشاهده نشد (25). با توجه به تأثير فعاليت هاي استقامتي بر بافت قلب و نقش miR-1 بر تجديد ساختار آن، هدف اين پژوهش بررسي تأثير 14 هفته تمرينات استقامتي (دويدن روي تردميل) بر بيان miR-1 عضلة قلب است.
مواد و روش ها
پژوهش حاضر اثر 14 هفته فعاليت استقامتي را بر بيان ژن miR-1 عضلة قلب به روش تجربي ارزيابي كرد. بدين منظور 20 سر رت صحرايي نر نژاد ويستار با 5 هفته سن (20±113گرم) از انستيتو پاستور خريداري شد. براي همة آنها شرايط مناسب آزمايشگاهي (دسترسي آزاد به آب و غذا مخصوص رت، چرخة روشنايي و تاريكي 12:12 ساعت، ميانگين دما 3±22 درجة سانتيگراد) بهصورت يكسان در آزمايشگاه حيوانات تا رسيدن به سن بلوغ فراهم شد. در اين مدت رتها در چهار قفس يكسان نگهداري شدند. در پايان اين مرحله، ميانگين و انحراف استاندارد وزن رتها عبارت بود از 24±231 گرم. سپس دورة آشناسازي رت ها با فعاليت استقامتي (دويدن روي تردميل با سرعت 9متر در دقيقه، به مدت 5 دقيقه و 4 روز در هفته) آغاز شد كه اين دوره 10 روز (5 جلسه) به طول انجاميد. در پايان جلسات آشناسازي، رت ها به صورت تصادفي به دو گروه (10سر به عنوان گروه كنترل و 10سر ديگر به عنوان گروه تمريني) تقسيم شدند. از گروه تمريني سه سر نتوانستند پروتكل را به پايان برسانند. از آنجا كه در روش Real time (نسبي) بايد تعداد گروه شاهد و تجربي مساوي باشد، با حذف سه سر از گروه كنترل (به طور تصادفي) تعداد نهايي به 14 سر(7 سر شاهد و 7 سر تجربي) كاهش يافت.
پروتكل تمريني
با استفاده از منابع پيشين يك پروتكل فعاليت استقامتي براي رت طراحي شد(26، 11)، به طوري كه به هايپرتروفي قلب و بطن چپ ناشي از فعاليت استقامتي منجر شود. پروتكل (14 هفته، هفته اي 6 روز) گروه تمريني عبارت بود از دويدن روي تردميل كه سرعت و شيب و زمان آن قابل برنامهريزي بود و در انتهاي آن يك شوكر براي جلوگيري از توقف تعبيه شده بود. هر جلسه با يك بخش 5 دقيقه اي با سرعت 12 متر در دقيقه براي گرم كردن شروع مي شد. در جلسة اول، بخش اصلي پروتكل 12 دقيقه بود. به طور هفتگي مدت زمان بخش اصلي پروتكل افزايش يافت (در هفته 3-1 هر روز 2 دقيقه به مدت زمان اجراي بخش اصلي پروتكل اضافه ميشد)، به طوري كه در پايان روز 23 مدت بخش اصلي پروتكل به 50 دقيقه رسيد كه با احتساب 5 دقيقه گرم كردن و 5 دقيقه سرد كردن، مدت زمان كلي 60 دقيقه بود. شدت تمرين با سرعت 20 متر در دقيقه شروع شد. سپس هر هفته 2 متر بر دقيقه به سرعت اضافه شد، به طوري كه در پايان هفتة ششم سرعت به 30 متر در دقيقه رسيد. در نهايت در هفتههاي 7 تا 10 به تدريج 5 درجه شيب (ابتداي هر هفته تقريباً 2/1 درجه شيب) نيز اضافه شد. اين پروتكل[60 دقيقه دويدن (شامل 5 دقيقه گرم كردن با سرعت 12 متر در دقيقه، 50 دقيقه دويدن با سرعت 30 متر در دقيقه، با شيب 5 درجه به عنوان بخش اصلي پروتكل و در نهايت 5 دقيقه دويدن با سرعت 9 متر در دقيقه بهعنوان بخش سرد كردن)] تا پايان هفتة 14 حفظ شد. پروتكل بين ساعات 5 تا 7 بعدازظهر هر روز اعمال ميشد. در نهايت 48 ساعت پس از پايان آخرين جلسة تمريني رت ها با تركيبي از كتامين (50 ميلي گرم به ازاي هر كيلوگرم) و زايلازين (5 ميلي گرم به ازاي هر كيلوگرم) بي هوش شدند. بعد از بي هوشي كامل (به طوري كه رت به تحريك اعمالشده پاسخ ندهد)، قلب رت ها در شرايط استريل خارج و بطن چپ آنها توسط متخصص آناتومي جدا شد. بافت مورد نظر (بطن چپ) بلافاصله در ميكروتيوبهايي با حجم 5/1 ميلي ليتر با برچسب متناسب با بافت، رت و ساعت تشريح جاسازي و وارد تانك نيتروژن شدند. بعد از تشريح و تا شروع هموژن بافت ها، همة آنها در دماي 80- درجة سانتي گراد نگهداري شدند. با استفاده از هاون و نيتروژن مايع بافتها هموژن و در ميكروتيوب هايي با حجم 5/1 ميلي ليتر با برچسب مناسب نگهداري شدند.
استخراج RNA از بافت
براي استخراج RNA از بافت هاي هموژن شده، به 100 ميلي گرم از بافت داخل ميكروتيوب، 1 ميلي ليتر تريزول (Invitrogen) اضافه شد و پس از مخلوط كردن كامل (پيپتاژ كردن) به مدت 5 دقيقه در دماي اتاق نگهداري (انكوبه) شد. سپس 2/0 ميلي ليتر به آن كلروفرم سرد اضافه شد و پس از پيپتاژ (15 ثانيه) حدود 2 تا 3 دقيقه در دماي اتاق انكوبه شد، در ادامه ميكروتيوب ها به مدت 15 دقيقه در دماي 4 درجة سانتي گراد با 12000 دور سانتريفيوژ (شركت eppendorff) شدند. سپس مايع رويي به دقت برداشته شد و به يك ميكروتيوب RNAase free انتقال داده شد (از اين مرحله به بعد با سرسمپلر فيلتردار كار شد). سپس 5/0 ميلي ليتر ايزوپروپانول سرد اضافه شد و بعد از هم زدن ملايم در دماي 20- باقي ماندند (overnight). روز بعد ميكروتيوب ها به مدت 15 دقيقه در دماي 4 درجة سانتي گراد با دور 12000 مجدداً سانتريفيوژ شدند كه در اين مرحله رسوب سفيدرنگي در ته بيشتر ميكروتيوب ها قابل مشاهده بود. با سمپلر (شركت eppendorff) مايع رويي با دقت خارج شد و 1 ميلي ليتر اتانول خالص سرد به آن اضافه شد و بعد از تكان دادن مختصر به مدت 5 دقيقه در دماي 4 درجه با دور 7500 سانتريفيوژ شدند و در ادامه مايع رويي به دقت تخليه شد و 10 دقيقه فرصت داده شد تا باقي ماندة اتانول تبخير و داخل ميكروتيوب خشك شود، بعد از اين مرحله 50 لاندا آب تزريقي به هر نمونه اضافه شد و چند بار به آرامي پيپتاژ صورت گرفت. در پايان غلظت و نسبت جذبي نمونه ها با استفاده از دستگاه اسپكتروفتومتر (شركت eppendorff) ارزيابي شد كه نسبت جذبي 280/260 نانومتر براي تمام نمونه ها بين 6/1 تا 8/1 بود. تمام مراحل كار زير هودي كه از قبل آماده شده بود ( استريل شده با الكل 75 درصد و نور UV) انجام ميشد. غير از مراحلي كه نياز بود، ميكروتيوبهاي حاوي مواد سانتريفيوژ يا ورتكس شوند. در طي مراحل از دستكش لاتكس بدون پودر استفاده مي شد و به محض نياز به تعويض دستكشها تعويض ميشد. كيت ها دقيقاً قبل از استفاده از يخچال 20 – خارج شده و بعد از استفاده به داخل يخچال منتقل مي شدند. تمام سمپلرها براساس زمانبندي هاي گروه كاليبره شده بودند. سنتز cDNA
براي رونويسي RNA به cDNA از كيت شركت Exiqon با 203300Cat # استفاده شد و تمام مراحل مطابق دستورالعمل شركت سازنده انجام گرفت. ترموسايكلر مورد استفاده در اين مرحله متعلق به شركت eppendorff بود.
ارزيابي بيان miR-1
براي ارزيابي بيان ژن از تكنيك Real Time PCR و دستگاه شركت Applied Biosystem استفاده شد.
SYBR Green master mix استفاده شده در اين مرحله متعلق به شركت Exiqon با Cat # 203450 بود. براساس دستورالعمل كيت براي يك نمونة 10 لانداي تركيبي از master mix (5 لاندا) پرايمر (1 لاندا) و 4 لاندا cDNA رقيق شده (1 به 80) در نظر گرفته شد و ميزان بيان miR-1 با استفاده از روش نسبي ارزيابي شد. در هر Run يك نمونه به عنوان كنترل منفي براي تعيين آلودگي master mix (طبق دستورالعمل شركت Applied Biosystem نبايد CT آن كمتر از 35 باشد) در نظر گرفته شد و كنترل داخلي (U6)، كنترل مثبت (گروه كنترل) و miR-1 همزمان (در يك Run واحد) ارزيابي شد. نمونه ها به صورت دوتايي (duplicate) ارزيابي شدند. بعد از به دست آوردن CT دوتايي براي هر نمونه ميانگين آنها محاسبه شد. شايان ذكر است در برخي موارد نياز بود كه test تكرار شود كه در صورت نياز تست تكرار مي شد. درصورتي كه CT پرتي مشاهده مي شد، همراه با نمونة كنترل آن از تحقيق حذف مي شدند. بعد از انتقال اطلاعات به نرمافزار Excel براساس فرمول ΔΔct-2 ميزان بيان miR-1 محاسبه شد (14). مشخصات پرايمرهاي استفاده شده در جدول 1 آمده است. پرايمرهاي miR-1 و رفرنس آن
.تهيه شد Exiqon از شركت U6 (Housekeeping) UGGAAUGUAAAGAAGUAUGUAU :عبارت است از miR-1 توالي

جدول 1. مشخصات پرايمرهاي مورد استفاده در پژوهش
miR-1 205104 rno-miR-1, LNA™ PCR primer set, UniRT .miRCURY LNA™ Universal RT microRNA PCR, microRNA primer set.
203907, U6 snRNA (hsa, mmu, rno) PCR primer set, UniRT.
U6 miRCURY LNA™ Universal RT microRNA PCR, reference gene primer set. NCBI Symbol U6snRNA, NCBI Accesion: x59362

تجزيه وتحليل دادهها
داده هاي به دست آمده از دستگاه Real Time PCR كه به صورت CT (ميانگين CT براي هر نمونه) بودند (31، 30، 24). با استفاده از نرمافزار Excel به ΔΔct تبديل شدند، سپس با استفاده از فرمول ΔΔct-2 اعداد نهايي به دست آمد (18). با انتقال اين اعداد به نرمافزار SPSS، ابتدا نرمال بودن توزيع داده ها با استفاده از آزمون Shapiro-Wilk ارزيابي و مشخص شد كه داده ها توزيع طبيعي دارند. بعد از تعيين نرمال بودن، براي تعيين اختلاف ميانگين ها از آزمون t تك نمونه اي (به اين دليل كه در روش real time هميشه ميزان بيان ژن در گروه كنترل بعد از تفاضل ژن رفرنس با ژن هدف تبديل به عدد يك مي شود) استفاده شد.
نتايج
نتايج آزمون t=1/47) t) نشان داد كه ميانگين بيان miR-1 قلب گروه تجربي نسبت به گروه كنترل در اثر 14 هفته تمرين استقامتي 68/1 برابر افزايش مييابد (شكل 1)، اما اين افزايش معنادار نبود
.(P=0/191)
جدول 2. نتايج آزمون t، مقايسة ميانگين گروه تجربي نسبت به گروه كنترل در عضلة قلب
Test Value = 1 آماره
-51167-206152

T miRs درجة معناداري تفاوت دامنة اطمينان تفاوت ها در سطح 95%
مقدار
آزادي (دوطرفه) ميانگين دامنةپايين دامنة بالا
1/7983 -0/44670/675770/19161/473 miR-1

شكل 1. تأثير يك دوره تمرين استقامتي بر بيان miR-1 عضلة قلب در گروه كنترل و تجربي
بحث و نتيجه گيري
براي اولين بار بود كه سازگاري ايجادشده در بيان miR-1 قلب در پي 14 هفته دويدن روي تردميل در رت ها مطالعه مي شد كه مشخص شد 14 هفته دويدن با شدت بالا تأثير معناداري بر بيان miR-1 قلب ندارد و تنها يك پژوهش سازگاري ايجادشده در بيان miR-1 قلب در اثر فعاليت هاي بدني را بررسي كرده بود (25) كه نتايج آن نشان داد تمرينات استقامتي بلندمدت (10 هفته شنا، 5 روز در هفته) با شدت متوسط و بالا موجب كاهش بيان miR-1 در بافت عضلة قلب مي شود (25). شايد تناقض ديده شده به شدت فعاليت برگردد، زيرا در پژوهش يادشده پروتكل تمرين استقامتي »كم شدت و طولاني« در نظر گرفته شده بود، اما در اين پژوهش شدت تمرين بالا بود. هرچند اين تنها پژوهشي است كه پاسخ بافت قلب به فعاليت هاي استقامتي را بررسي كرد، كه شدت و مدت پروتكل تمريني پ ژوهش ذكرشده با اين تحقيق متفاوت بود.
در تحقيق روي رت ها مشخص شد كه بعد از اضافه بار فشاري (القاكنندة هايپرتروفي نوع پاتولوژيكي) كاهش miR-1 يكي از سريع ترين تغييراتي است كه حتي قبل از افزايش تودة قلب رخ مي دهد (23)، ضمن اينكه بيان miR-1 در بطن هايپرتروفيشدة افراد بيمار نيز كاهش مي يابد (9). از طرف ديگر مشخص شده كه در نارسايي قلبي بيان miR-1 متفاوت است. درحالي كه برخي پژوهشگران مشاهده كرده اند كه بيان miR-1در ايسكمي و كارديوميوپاتي گشاده شده كاهش مييابد (9). برخي ديگر گزارش كرده اند كه ميزان بيان آن افزا يش مي يابد (27). در اين زمينه هان (2011) نشان داد كه بيان miR-1 در هايپرتروفي كاهش مييابد، اما زماني كه نارسايي قلب پيشرفته شود، به حالت اول يا بيشتر از آن بر مي گردد (7). بنابراين مي توان گفت كه بيان miR-1 با هايپرتروفي قلب در ارتباط است، اما اينكه آيا تمايزي در بيان miR-1 در انواع هايپرتروفي ديده ميشود يا نه؟ مشخص نيست، زيرا هايپرتروفي كه در اثر فعاليت هاي بدني رخ مي دهد با آنچه در اثر نارسايي هاي قلبي يا فشار خون رخ ميدهد متفاوت است (8). اين تفاوت بيشتر در سطح عملكردي قلب مشخص مي شود، هايپرتروفي نوع فيزيولوژيك موجب بهبود عملكرد قلب و نوع پاتولوژيك آن موجب كاهش كارايي قلب ميشود (33).
يكي از ژن هاي هدف miR-1 ژن هيستون داستيلاز-4 (HDAC4) است (28) كه موجب فشردگي
كرماتين مي شود، بنابراين دسترسي RNA پلي مراز به DNA براي آغاز رونويسي بهشدت محدود مي شود (12)، در پاييندست HDAC4 فاكتور 2 افزايش دهندة ميوسيت (MEF2) قرار دارد (16) كه در حقيقت القاكنندة تارهاي نوع كند است (21). HDAC4 سركوب كنندة MEF2 است(16). بنابراين اگر فعاليت هاي استقامتي به كاهش بيان miR-1 منجر شود، بيان HDAC4 افزايش مييابد و MEF2 سركوب مي شود، نتيجة نهايي كاهش بيان زنجيرة سنگين نوع بتا MHCβ يا تارهاي نوع كند است كه در حقيقت به افزايش كارايي قلب منجر مي شود. فارغ از فرايندهاي پس ترجمهاي انتظار اين است كه بيان miR-1 در اثر فعاليتهاي استقامتي كه به كارايي قلب منجر مي شود، كاهش يابد. البته پژوهشي نياز است تا برايند اين تغييرات را در سطح پس رونويسي بررسي كند، زيرا در اين حالت مي توان ديدگاه جامع تري نسبت به اين موضوع پيدا كرد. اگر پيشنهاد هان مبني بر تغييرات miR-1 را در نظر بگيريم، افزايش miR-1 در اين تحقيق ممكن است ناشي از شدت بالاي تمرينات استقامتي بوده باشد. مهمترين محدوديت اين تحقيق اين بود كه ما نتوانستيم ميزان بيان پروتئين هايي را كه تحت تأثير miR-1 هستند، ارزيابي كنيم، زيرا با ارزيابي اين پروتئين ها مي توان دورنماي بهتري از عملكرد miR-1 به دست آورد.
به طور خلاصه نتايج اين تحقيق نشان داد كه فعاليت هاي استقامتي تأثير معناداري بر بيان miR-1 ندارد. از آنجا كه عمده تأثيرات miRs پس از رونويسي مشخص مي شود، احتمال دارد تغييرات miR-1 هرچند كم، در سطح پروتئين ژن هاي هدف آن مشخص شود، بنابراين پيشنهاد مي شود كه سطوح پروتئيني ژن هاي هدف miR را در اثر فعاليت هاي استقامتي اندازه گيري كند.

منابع و مĤخذ
Callis, T.E. and D.Z. Wang. (2008). Taking microRNAs to heart. Trends Mol Med, 14(6):
p. 254-60.
Chen, J.F., et al. (2006). The role of microRNA-1 and microRNA-133 in skeletal muscle
proliferation and differentiation. Nature Genetics, 38(2): p. 228-233.
Costantini, D.L., et al. (2005). The homeodomain transcription factor Irx5 establishes the mouse cardiac ventricular repolarization gradient. Cell, 123(2): p. 347-58.
Czubryt, M.P. and E.N. Olson. (2004). Balancing contractility and energy production: the role of myocyte enhancer factor 2 (MEF2) in cardiac hypertrophy. Recent Prog Horm
Res. 59: p. 105-24.
Davidsen, P.K., et al. (2011). High responders to resistance exercise training demonstrate differential regulation of skeletal muscle microRNA expression. Journal of Applied Physiology. 110(2): p. 309-317.
Drummond, M.J., et al. (2008). Aging differentially affects human skeletal muscle microRNA expression at rest and after an anabolic stimulus of resistance exercise and essential amino acids. Am J Physiol Endocrinol Metab. 295(6): p. E1333-40.
Han, M., J. Toli, and M. Abdellatif. (2011). MicroRNAs in the cardiovascular system.
Curr Opin Cardiol. 26(3): p. 181-9.
Hill, J.A. and E.N. Olson. (2008). Cardiac plasticity. N Engl J Med. 358(13): p. 1370-80.
Ikeda, S., et al. (2007). Altered microRNA expression in human heart disease. Physiol Genomics. 31(3): p. 367-73.
Ivey, K.N., et al. (2008). MicroRNA regulation of cell lineages in mouse and human embryonic stem cells. Cell Stem Cell. 2(3): p. 219-29.
Jin, H., et al. (2000). Effects of exercise training on cardiac function, gene expression, and apoptosis in rats. Am J Physiol Heart Circ Physiol. 279(6): p. H2994-3002.
Kehat, I., et al. (2011). Modulation of chromatin position and gene expression by HDAC4 interaction with nucleoporins. J Cell Biol. 193(1): p. 21-9.
Lee, C.T., T. Risom, and W.M. Strauss. (2007). Evolutionary conservation of microRNA regulatory circuits: an examination of microRNA gene complexity and conserved microRNA-target interactions through metazoan phylogeny. DNA Cell Biol. 26(4): p. 209-18.
Livak, K.J. and T.D. Schmittgen. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔct Method. Methods. 25(4): p. 402-8.
McCarthy, J.J. and K.A. Esser. (2007). MicroRNA-1 and microRNA-133a expression are decreased during skeletal muscle hypertrophy. Journal of Applied Physiology. 102(1): p. 306-313.
Miska, E.A., et al. (1999). HDAC4 deacetylase associates with and represses the MEF2 transcription factor. EMBO J. 18(18): p. 5099-107.
Nielsen, S., et al. (2010). Muscle specific microRNAs are regulated by endurance exercise in human skeletal muscle. J Physiol. 588(Pt 20): p. 4029-37.
Pfaffl, M.W. (2001). A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29(9): p. e45.
Pluim, B.M., et al. (2000). The athlete’s heart: a meta-analysis of cardiac structure and function. Circulation. 101(3): p. 336-344.
Potthoff, M.J., E.N. Olson, and R. Bassel-Duby. (2007). Skeletal muscle remodeling. Current Opinion in Rheumatology. 19: p. 542-549.
Potthoff, M.J., et al. (2007). Histone deacetylase degradation and MEF2 activation promote the formation of slow-twitch myofibers. J Clin Invest. 117(9): p. 2459-67.
Safdar, A., et al. (2009). miRNA in the Regulation of Skeletal Muscle Adaptation to Acute Endurance Exercise in C57Bl/6J Male Mice. PLoS One. 4(5): p. e5610.
Sayed, D., et al. (2007). MicroRNAs play an essential role in the development of cardiac hypertrophy. Circ Res. 100(3): p. 416-24.
Schmittgen, T.D. and K.J. Livak. (2008). Analyzing real-time PCR data by the comparative CT method. Nature Protocols. 3(6): p. 1101-1108.
Soci, U.P., et al. (2011).MicroRNAs 29 are involved in the improvement of ventricular compliance promoted by aerobic exercise training in rats. Physiol Genomics. 43(11): p. 665-73.
Sun, L., et al. (2010).Endurance exercise causes mitochondrial and oxidative stress in rat liver: effects of a combination of mitochondrial targeting nutrients. Life Sci. 86(1-2): p. 39-44.
Thum, T., et al. (2007). MicroRNAs in the human heart: a clue to fetal gene reprogramming in heart failure. Circulation. 116(3): p. 258-67.
van Rooij, E., N. Liu, and E.N. Olson. (2008). MicroRNAs flex their muscles. Trends in Genetics. 24(4): p. 159-166.
Weiner, R.B. and A.L. Baggish. (2012). Exercise-induced cardiac remodeling. Prog Cardiovasc Dis. 54(5): p. 380-6.
Wong, M.L. and J.F. Medrano. (2005). Real-time PCR for mRNA quantitation.
Biotechniques. 39(1): p. 75-85.
Yuan, J.S., et al. (2006). Statistical analysis of real-time PCR data. BMC Bioinformatics. 7: p. 85-97.
Zhao, Y., D. Srivastava, and E. Samal. (2005). Serum response factor regulates a musclespecific microRNA that targets Hand2 during cardiogenesis. Nature. 436(7048): p. 214-220.
Zhua, S.S., et al. (2008). Left ventricular function in physiologic and pathologic hypertrophy in Sprague–Dawley rats. Science & Sports. 23 p. 299-305.



قیمت: تومان

برای دانلود متن کامل پایان نامه ها اینجا کلیک کنید


پاسخی بگذارید