علوم زيستي ورزشي _ تابستان 1395 دورة8، شمارة 2، ص : 169 – 176 تاريخ دريافت : 13 / 02 / 93 تاريخ پذيرش : 07 / 06 / 94

تأثير هشت هفته تمرينات تناوبي شديد بر بيان ژن هاي PGC-1α وVEGF در
عضلة قلبي رت هاي نر سالم

مريم شعباني 1– سيروس چوبينه 2 – محمدرضا كردي 3 – مرجان افغان 4
1.مربي، دانشگاه آزاد اسلامي واحد هشتگرد، البرز، ايران 2و3. دانشيار، دانشكدة تربيت بدني و علوم ورزشي، دانشگاه تهران، تهران، ايران 4.دانشجوي دكتري فيزيولوژي ورزشي، دانشكدة تربيت بدني و علوم ورزشي،
دانشگاه شهيد رجايي، تهران، ايران

چكيده
اين تحقيق با هدف تعيين تأثير هشت هفته تمرين تناوبي شديد بر بيان ژن VEGF و PGC–1α در عضلة قلبي رت هاي نر سالم انجام گرفت. دوازده سر رت نر بالغ از نژاد ويستار به دو گروه آزمون (تمرين تناوبي شديد) و كنترل تقسيم شدند. گروه آزمون، به مدت هشت هفته و هر هفته پنج جلسه، تمرينات شامل دويدن با شدت 100-90 درصد VO2max را به مدت 4 دقيقه روي نوار گردان انجام دادند و همزمان، گروه كنترل به مدت پانزده دقيقه روي تردميل با سرعت دو متر در دقيقه قرار گرفتند. در روز بعد از آخرين جلسه، رت ها تشريح و نمونه ها به منظور استخراج RNA به آزمايشگاه منتقل شدند. بيان ژن PGC-1α و VEGF در گروه آزمون نسبت به گروه كنترل به ترتيب 2/1 (79/0=P) و 4/1 برابر (29/0=P) بود. نتايج نشان دهندة افزايش غيرمعنادار ميزان بيان ژن PGC1-α و VEGF در عضلة قلب در پي هشت هفته تمرين تناوبي با شدت بالاست.

واژه هاي كليدي
تمرين تناوبي شديد، عضلة قلبي، فاكتور رشد اندوتليال عروقي، فعال كنندة تكثير پروكسي زوم آلفا.
مقدمه
ميتوكندري ها، شركت كننده هاي ثابت در پيامرساني سلولياند كه به آپپتوزيس (مرگ سلولي برنامه ريزي شده) منجر مي شوند. افزايش تعداد و اندازة ميتوكندري كه تودة ميتوكندريايي خوانده مي شود، احتمالاً مهم ترين سازگاري درازمدت افزايش استقامت عضلاني است. بيوژنز ميتوكندريايي يعني هر گونه افزايش در تعداد و تودة ميتوكندري يا ميزان آنزيم ها و جايگاه هاي سيتوكروم اكسيداز كه سبب افزايش عملكرد ميتوكندري ها و ميزان توليد ATP و متابوليسم چربيها مي شود (3).
PGC-1 يك گيرندة سلولي است و انتشار پروتئين هاي ميتوكندريايي را تسهيل مي كند. PGC-1 دو ايزوفرم آلفا و بتا دارد، البته هر دو آنها در اين فرايند دخيل اند، ولي آلفا مهم تر است. گزارش شده است تمرينات هوازي ميتوانند آن را افزايش دهند (5،8،9). PGC-1 مهم ترين تنظيم كننده در بيوژنز ميتوكندريايي است كه از طريق فعال كردن گروهي از عوامل انتقالي سبب افزايش بيوژنز ميتوكندريايي شده و خود تحت تأثير عواملي فعال ميشود (2). براي سنتز پروتئين PGC-1، ابتدا بايد ژن PGC-1 در سلول عضلاني يا قلبي بيان و پس از رونويسي به محتواي پروتئيني سنتز شود (1).
فرايند مهم ديگري كه PGC-1α در عضلة اسكلتي تنظيم مي كند، رگ زايي است. اين نقش PGC-α1 را مي توان ايفاي نقش بين ميزان تقاضا و عرضه تعبير كرد. اشاره شد كه با افزايش PGC-1α محتواي ميتوكندريايي و ميزان سوخت وساز عضله افزايش مي يابد و عضله به جريان خون بيشتري نياز پيدا ميكند. PGC-1α اين نياز را از طريق تحريك مسير پيام رساني بتا آدرنرژيك تنظيم ميكند و محتواي تودة رگي عضله را افزايش ميدهد. آنژيوژنز، فرايند افزايش چگالي مويرگ هاي بافتي از جمله عضلة اسكلتي و قلبي است. ايجاد مويرگ، نيازمند تكثير و مهاجرت سلولهاي اندوتليال مويرگي است. فاكتورهاي رشد زيادي در فرايند آنژيوژنز درگيرند، اما بيشتر تحقيقات VEGF را مهمترين فاكتور رشدي درگير در اين فرايند ذكر كردهاند. واسطة بين PGC-1α و عامل رشد اندوتليال عروقي (VEGF) در اين مسير گيرندة آلفاي وابسته به استروژن 3(ERRα) است؛ يعني PGC-1α از طريق افزايش ERRα سبب بيان VEGF در عضلة اسكلتي ميشود كه در پي آن تودة رگي عضلة اسكلتي افزايش م ييابد (4). با توجه به اينكه افزايش چگالي مويرگي و بيوژنز ميتوكندريايي در عضلات اسكلتي و همينطور بافت قلب، از مقدمات مهم توسعة توان هوازي و نيز پيشگيري و درمان بسياري از بيماري ها به شمار مي رود، شناخت صحيح فعاليتهاي ورزشي كه به بهترين شكل ممكن سبب بروز پديدة آنژيوژنز و بيوژنز ميتوكندريايي ميشوند، اهميت بسزايي دارد. با وجود مطالعات متعدد در زمينة تأثير فعاليت ورزشي بر بيان ژنهاي VEGF و PGC– 1α در بافت عضلة اسكلتي، تا به حال تأثير تمرين تناوبي شديد بر بيان عوامل نامبرده مطالعه نشده است. ازاين رو مطالعة حاضر با هدف تعيين تأثير هشت هفته تمرين تناوبي شديد بر بيان ژن VEGF و PGC– 1α در عضلة قلبي رت هاي نر سالم انجام گرفت.
مواد و روش ها
در تحقيق حاضر كه از نوع تجربي بنيادي بود، دوازده سر رت نر بالغ از نژاد ويستار از انستيتو پاستور با ميانگين وزني 20±180 گرم و سن هشت هفته خريداري و به آزمايشگاه حيوانات دانشكدة تربيت بدني و علوم ورزشي دانشگاه تهران منتقل شدند. سپس رتها به مدت سه روز براي سازگاري با محيط و رسيدن به حد وزني مطلوب (200+ گرم) نگهداري شدند. آشناسازي رت ها با پروتكل ورزشي تناوبي شديد با 10 جلسه تمرين در دو هفته انجام گرفت.
نمونه ها به دو گروه آزمون (تمرين تناوبي شديد) و كنترل تقسيم شدند. حيوانات تحت چرخة خواب و بيداري (12 ساعت روشنايي و 12 ساعت تاريكي) و در دماي 3±22 درجه سانتيگراد و رطوبت 40 تا 60 درصد نگهداري شدند. آب حيوانات از طريق ظروف پلاستيكي مخصوص كه روي در قفس قرار داشتند، تأمين شد و در طول پژوهش دسترسي به آب و غذا براي حيوان آزاد بود.
با توجه به دسترسي نداشتن به ابزار مستقيم مانند تجزيهوتحليل گازهاي تنفسي، با توجه به مطالعة هويدال و همكاران در سال 2007 (6) پروتكل غيرمستقيم ولي با دقت زياد به كار رفت. ازاين رو، مقدار VO2max رتها با توجه به سرعت دويدن روي نوار گردان تعيين شد. گروه آزمون، به مدت هشت هفته و هر هفته پنج جلسه، تمرينات مربوط را كه شامل دويدن با شدت 90 تا 100 درصد VO2max روي نوار گردان مخصوص جوندگان بود، در رأس ساعت مشخصي (19 تا 21) انجام دادند و در همين زمان، گروه كنترل براي يكسانسازي اثر استرس به مدت پانزده دقيقه روي تردميل با سرعت دو متر در دقيقه قرار گرفتند. طرح پروتكل تمرين تناوبي شديد در اين مطالعه در جدول 1 ارائه شده است. در دورة تمرين به هيچ عنوان از دستگاه شوك الكتريكي براي شرطيسازي حيوانات بهدليل انتقال استرس منفي به حيوان استفاده نشد. در زمان تمرين گروه آزمون، شيب تردميل در هشت هفته تغييري نكرد (شيب صفر درجه). كلية جلسات تمرين در زير نور قرمز (به علت قرار داشتن چرخة فعاليت آنها در تاريكي) انجام گرفت.
در روز بعد از آخرين جلسة تمرين، رت ها تشريح شدند. نمونه هاي بافت قلب از ناحية ريشه آئورت جداسازي شده، بلافاصله در ازت مايع منجمد شدند، به طوري كه فاصلة زماني بين جداسازي تا انجماد كمتر از سه دقيقه بود. سپس، اين نمونه ها به منظور استخراج RNA به آزمايشگاه انتقال داده شدند.

جدول 1. طرح پروتكل تمرين تناوبي شديد سرد كردن گرم كردن نبد ة اصلي تمرين (3 تناوب)تناوب شديدتناوب كم شدت مراحل تمرين مؤلفة تمرين
6 دقيقه 6 دقيقه 4 دقيقه 2 دقيقه زمان تمرين (دقيقه)
1073322217011

براي بررسي بيان ژن هاي PGC1 وVEGF با استفاده از تكنيك Pars ) SYBER Green Real-time PCRGenome Real-time PCR kit)، ابتدا RNA تام سلولي از بافت ها به دقت استخراج شده و پس از حصول اطمينان از سالم بودن RNA استخراج شده، واكنش رونويسي معكوس انجام گرفت و cDNA توليد شد (Pars Genome microRNAs cDNA synthesis kit)، براي نمونه DNA الگو، با استفاده از پرايمرهاي طراحي شده كه در جدول 2 آورده شده است، براي انجام واكنش PCR استفاده شد. براي تعيين ميزان بيان نسبي گروه آزمون نسبت به گروه كنترل از نرم افزار REST نسخة 2009 استفاده شد. سطح معنا داري 05/0< P در نظر گرفته شد.
50 تا 60 درصد شدت تمرين (VO2max) 50 تا 60 درصد90 تا 100 درصد50 تا 60 درصد

جدول 2. توالي پرايمرهاي ژن هاي PGC-1α و VEGF
ژن Forward پرايمر Reverse پرايمر
PGC-1α ACCCACAGGATCAGAACAAACC GACAAATGCTCTTTGCTTTATTGC
VEGF ACTCCAGGGCTTCATCATTGAATTGAGACCCTGGTGGACA

يافته هاي پژوهش
بيان ژن PGC1 در گروه آزمون نسبت به گروه كنترل 2/1 برابر بود كه اين افزايش از نظر آماري معنا دار نبود (79/0=P). همچنين، بيان ژن VEGF در گروه آزمون نسبت به گروه كنترل 4/1 برابر بود كه افزايش غيرمعنا داري را نشان داد (29/0=P) (نمودار 1).

نمودار 1. بيان نسبي ژن هاي PGC1 و VEGF در گروه آزمون نسبت به كنترل بحث و نتيجه گيري
در اين پژوهش تأثير اجراي HIIT بر بيان ژن هاي PGC1-α و VEGF در بافت قلب رت هاي نر نژاد ويستار بررسي شد. نتايج نشان دهندة افزايش غيرمعنا دار ميزان بيان ژن PGC1-α و VEGF در عضلة قلب در پي هشت هفته تمرين تناوبي با شدت بالاست. از آنجا كه پژوهش حاضر نخستين پژوهش در زمينة تأثير طولانيمدت اجراي HIIT بر بيان ژن هاي PGC1-α و VEGF در بافت قلب است، مطالعات مشابهي كه بتوان نتايج آن را با يافته هاي اين پژوهش مقايسه كرد، موجود نيست. ازاين رو، نتايج اين پژوهش با يافته هاي مطالعاتي كه ميزان بيان ژن هاي نامبرده يا محتواي پروتئيني آنها را در عضلة اسكلتي بررسي كردهاند، مقايسه شد.
در زمينة اجراي HIIT و بيوژنز ميتوكندريايي چندين مطالعه انجام گرفته است كه به طور معمول در آنها پاسخ يك وهله فعاليت يا تأثير دو هفته تمرين بررسي شدهاند. ترادا و همكاران در سال 2005 نشان دادند كه يك وهله شناي تناوبي شديد بر بيان ژن پروتئين PGC1-α در عضلة اسكلتي رت ها تأثير افزايشي داشته است. فعاليت رت ها شامل ست هايي متشكل از فعاليت شديد 20 ثانيه اي و بهدنبال آن 10 ثانيه استراحت بود. مشاهده شد محتواي PGC1-α در عضلات، بلافاصله پس از فعاليت 10%، پس از دو ساعت 110%، پس از 6 ساعت 140% و پس از 18 ساعت 110% افزايش داشته است (10).
همچنين، ليتل و همكاران در سال 2010 در تحقيقي تأثير دو هفته اجراي HIIT را بر محتواي پروتئيني PGC1-α در عضلات هفت مرد جوان سالم بررسي كردند. در اين پژوهش، آزمودني ها شش جلسة تمريني شامل هشت تا دوازده تكرار 60 ثانيه اي با 100% VO2max (ركاب زدن) و 75 ثانيه بازيافت را طي دو هفته انجام دادند. پس از دو هفته، از عضلة پهن خارجي نمونه برداري شد و مشاهده كردند مقدار پروتئين PGC1-α هسته 24 درصد افزايش يافت، اما محتواي آن در كل عضله تغييري نكرده بود. يكي از محدوديت هاي اين پژوهش عدم امكان برداشت بافت (بايوپسي) بيشتر در انسان است كه اندازه گيري رسوب پروتئيني بيشتر PGC1-α را امكان پذير سازد (8).
اشاره شد كه با افزايش PGC-1α محتواي ميتوكندريايي و ميزان سوخت وساز عضله افزايش مييابد كه عضله به جريان خون بيشتري نياز پيدا ميكند. واسطة بين PGC-1α و عامل رشد اندوتليال عروقي (VEGF) در اين مسير گيرندة آلفاي وابسته به استروژن (ERRα) است؛ يعني PGC-1α از طريق افزايش ERRα موجب بيان VEGF در عضلة اسكلتي مي شود كه بهدنبال آن تودة رگي عضلة اسكلتي افزايش مي يابد (4).
با توجه به گزارش هاي حاضر و نتايج اين پژوهش فعاليت ورزشي متناوب پرشدت مي تواند بر بيان ژن VEGF و PGC-1α بافت قلب تأثير مثبت بگذارد و سبب افزايش آن شود. هرچند افزايش اين مقادير در عضلة قلب معنادار نبود، مي توان گفت به دليل اينكه قلب به بيشينة قابليت اكسايشي خود رسيده و نيز تجمع لاكتات و در پي آن تغييرات اسيدي-بازي تأثير كمتري بر كاركرد قلب مي گذارد، اين افزايش در قلب معنا دار نبوده است (11). به علاوه احتمالاً پروتكل تمريني در پژوهش حاضر از دسته فعاليت هاي ورزشي محسوب ميشود كه كاركرد خود را بيشتر بر عضلات محيطي نشان ميدهد و بر قلب فشار كمتري وارد مي آورد و شايد بتوان گفت پروتكل تمريني حاضر براي بهبود بيماري هاي قلبي مانند آترواسكلروز مي تواند بدون وارد آوردن فشار زياد بر قلب نتايج خوبي به همراه داشته باشد. اين مطلب را لينكز و همكاران (2006) مبني بر مفيد و كاربردي بودن اجراي HIIT براي بيماران قلبي-عروقي تأييد كرده اند (7).
با توجه به اينكه ظرفيت اكسايشي در حالت پايه در حداكثر است، به طور معمول علت اصلي محدودي تهاي توان هوازي را بايد در مقاومت محيطي عضلات با ظرفيت اكسايشي كمتر جستوجو كرد. در ضمن عضلات اسكلتي را مي توان محدوديتي در افزايش و بهبود عملكرد قلب دانست، چراكه هر زماني برنامة ورزشي بخواهد فشار عمده اي بر قلب وارد كند و در پي آن سازگاريهاي فزاينده ايجاد شود، احتمالاً محدوديت و مقاومت عضلاني و همچنين خستگي عضلاني از اين روند جلوگيري خواهد كرد و به ناچار شدت و ميزان فشار با توجه به سطح توانايي كمتر عضلة اسكلتي كاهش خواهد يافت.
از طرفي شايد بتوان افزايش غير معنادار بيان ژن VEGF در عضلة قلبي را به عوامل مؤثر در ايجاد VEGF مانند هايپوكسي نسبت داد. همانطوركه گفته شد، تقريباً قلب به حداكثر ميزان ظرفيت اكسايشي خود رسيده است، ازاين رو عواملي كه مي توانند در اثر هايپوكسي بافت در عضلة اسكلتي سبب تحريك بيان ژن VEGF شوند (مانند HIF-1)، احتمالاً در قلب تأثير چنداني نخواهند گذاشت. با اين حال، به منظور اثبات اين نظريه، انجام پژوهشهاي بيشتر دربارة تأثير تمرين تناوبي شديد بر بيان ژن هاي نامبرده در بافت قلب ضروري است.
منابع و مĤخذ
1.Aoi, W., Naito, Y., Mizushima, K., Takanami, Y., Kawai, Y., Ichikawa, H., & Yoshikawa, T. (2010). “The microRNA miR-696 regulates PGC-1α in mouse skeletal muscle in response to physical activity”. American Journal of Physiology-Endocrinology and Metabolism, 298(4), E799-E806.
2.Booth, F. W., Chakravarthy, M. V & ,.Spangenburg, E. E .(2002) .“Exercise and gene expression: physiological regulation of the human genome through physical activity .
“Journal of Physiology 543.2: 399-411.
3.Canto, C & ,.Auwerx, J .(2009) .“PGC-1a, SIRT1 and AMPK, an energy sensing network that controls energy expenditure”. Curr Opin Lipidol. 20(2): pp: 98–105.
4.Chinsomboon J,Ruas J,Gupta R, et al.2009. “The transcriptional coactivator PGC-1α mediates exercise-induced angiogenesis in skeletal muscle. Proceeding of the National Academy of Sciences”. 106(50), 21401-21406.
5.Coffey, V. G & ,.Hawley, J. A .(2007) .”The molecular bases of training adaptation.”
Sports medicine, 37(9): pp: 737-763.
6.Hoydal M A, Wisloff U,Kemi O J, et al.2007. “Running speed and maximal oxygen uptake in rats and mice: practical implications for exercise training.” European Journal of Cardiovascular Prevention & Rehabilitation.14 (6), 753-760.
7.Lienkens S,De Clercq E, Neyts J, et al. 2001. “Angiogenesis: regulators and clinical applications. Biochemical Pharmacology.” 61(3): 253-70.
8.Little, J. P., Safdar, A., Wilkin, G. P., Tarnopolsky, M. A & ,.Gibala, M. J .(2010) .“A practical model of low-volume high-intensity interval training induces mitochondrial biogenesis in human skeletal muscle: potential mechanisms.” J Physiol. 588(6): pp: 10111022
9.Russell, A. P., Feilchenfeldt, J., Schreiber, S., Praz, M., Crettenand, A., Gobelet, C, et al. (2003). “Endurance Training in Humans Leads to Fiber Type-Specific Increases in Levels of Peroxisome Proliferator-Activated Receptor-γ Coactivator-1 and Peroxisome Proliferator-Activated Receptor-α in Skeletal Muscle.” Diabetes. 52 (12): pp: 2874 –2881
10.Terada S, Kawanaka K, Goto M, et al. (2005). “Effect of high-intensity intermittent swimming on PGC-1α protein expression in rat skeletal muscle.” Acta Physiological Scandinavica. 184(1), 59-65.
11.Urlik Wisloff A, Stoylen A, Loennechen J P, et al. (2007). “Superior cardiovascular effect of aerobic interval training versus moderate continuous training in heart failure patient”.
Circulation, 115(24):3086-94.



قیمت: تومان


دیدگاهتان را بنویسید