علوم زيستي ورزشي _ زمستان 1394 دورة7، شمارة 4، ص : 605 – 618 تاريخ دريافت : 02 / 11 / 93 تاريخ پذيرش : 25 / 12 / 93
تأثير تمرين هوازي در هواي آلوده به ذرات كربن سياه بر بيان ژن TLR4
و TNF-α بافت رية موش هاي صحرايي نر

محمد فشي1 – حميد آقاعلي نژاد2 – حسن اصيليان مهابادي3 – بتول رضايي4 – بهزاد پاك راد5
1.استاديار دانشكدة تربيت بدني و علوم ورزشي دانشگاه شهيد بهشتي، تهران، ايران 2.دانشيار فيزيولوژي ورزشي گروه تربيت بدني و علوم ورزشي دانشگاه تربيت مدرس، 3.دانشيار مهندسي بهداشت حرفه اي، گروه بهداشت حرفه اي و محيط، دانشكدة علوم پزشكي، دانشگاه تربيت مدرس، تهران، ايران 4.دكتري فيزيولوژي
ورزشي گروه تربيت بدني و علوم ورزشي دانشگاه تربيت مدرس، تهران ، ايران 5. دكتري فيزيولوژي ورزشي گروه تربيت بدني و علوم ورزشي دانشگاه تربيت مدرس، تهران، ايران

چكيده
هدف از پژوهش حاضر بررسي تأثير تمرين هوازي در هواي آلوده به ذرات كربن سياه بر بيان ژن TLR4 و TNF-α در موش هـاي صـحرايي نـر اسـت . بـه ايـن منظـور 24 سـر مـوش صـحرايي نـر از نـژاد ويسـتار بـا ميـانگين تـودة بـدني97/26±29/279 گرم به طور تصادفي در چهار گروه الف) كنترل، ب) تمرين هوازي، ج) آلـودگي و د) آلـودگي + تمـرين قرار گرفتند. از دستگاه تزريق ذرات و اتاقك (فالونك) به منظور قرارگيري حيوانات در معرض ذرات كـربن سـياه بـا قطـركمتر از 10 ميكرون استفاده شد. پروتكل تمرين هوازي با 50 درصد بيشينة سرعت هـر گـروه بـه مـدت 4 هفتـه انجـامگرفت و 24 ساعت پس از آخرين جلسة تمريني و قرارگيري در معـرض ذرات كـربن سـياه حيوانـات قربـاني شـدند. بـا
استفاده از تكنيك Real time-Pcr بيان ژن TLR4 و TNF-α در بافت رية موش ها ارزيابي شـد . بـه منظـور تعيـينمعنادار بودن تفاوت بين گروه ها از تحليل واريانس چندسـويه و آزمـون تعقيبـيLSD و آزمـون ناپارامتريـك فريـدمن استفاده شد. تمرين هوازي، به كاهش بيان ژن TLR4 و TNF-α در موش هاي در معرض ذرات كربن سياه منجر شـد.
همچنين، تمرين با كاهش معنا دار تودة بدن در گروه هاي در معرض ذرات كربن سـياه همـراه شـد. چهـار هفتـه تمـرينهوازي در هواي آلوده به ذرات كربن سياه به تعديل عوامل التهابي TLR4 و TNF-α و تودة بدن منجر مي شود. بهنظر مي رسد اين تغييرات در بخشي با كاهش خطر ابتلا به بيماري هاي ريوي همراه باشد.

واژه هاي كليدي
التهاب، بافت ريه، تمرين هوازي، بافت ريه،كربن سياه.
مقدمه
امروزه آلودگي هوا در شهرهاي بزرگ و صنعتي موجب نگراني شده است. زندگي در هواي آلوده و انجامفعاليت هاي روزمره و فعاليت هاي ورزشي نگراني هاي زيادي را براي افراد در معرض آلودگي هوا ايجادكرده است. آلودگي هوا در شهرهاي بزرگ بيشتر ناشي از دود اتومبيل ها، كارخانه ها و غيره است كه مهم ترين اجزاي آن را مونوكسيد كربن (CO)، اكسيد نيتروژن (NOX)، ازون (3O)، ريز ذرات (10PM)، دياكسيد سولفور (2SO) و اجزاي ارگانيك فرار (VOCs) تشكيل مي دهد (22،5، 1). برخي مطالعات نشان داده اند طبيعت فيزيكي و شيميايي آلودگي هوا كه از عواملي مانند اندازة ذرات، فصل و موقعيت جغرافيايي (17، 14، 7 ،5) ناشي مي شود، در فعال كردن مسيرهاي التهابي نقش دارد كه در اين بين ليگاندهاي داخلي و خارجي – گيرنده هاي شبه تول – نقش مهمي دارند (40). گيرنده هاي TLR در سطح سلول و در غشاهاي داخلسلولي يافت مي شوند، بنابراين مي توانند ميكروب ها و عوامل خارجي را در نقاط مختلف سلول شنا سايي كنند و با فعال كردن مسيرهاي فرودست با توسعة التهاب حاد و علائم تنفسي و تشديد شرايط التهاب مزمن، آسم و بيماري هاي قلبي- تنفسي را منجر شوند (22 ،10). بسياري از ميانجي هاي التهاب نقش مهمي در هر دو پاسخ هاي سلولي و فيزيولوژيكي به ذرات آلودگي هوا دارند كه از آن جمله مي توان به سا يتوكاينها و كموكاين ها اشاره كرد (3). آلن و همكاران (2005) رابطة بين قرارگيري در معرض اجزاي آلودگي هوا و تغييرات معنادار عوامل التهابي و عملكرد ريه را در كودكان ارزيابي كردند. دو ساعت قرارگيري در معرض آلودگي هوا موجب كاهش عملكرد ريه (حجم بازدم اجباري در 1 ثانيه و ظرفيت حياتي اجباري) و افزايش التهاب نوتروفيل ها شد (4). از بين مواد آلاينده، ذرات معلق توجه ويژه اي را به خود جلب كرده است. ذرات معلق با قطر آيروديناميكي كمتر از 10 ميكرومتر (PM10) به دليل راهيابي به سيستم تنفسي تحتاني، شاخص اصلي مواد معلق در هواست
(8). براساس مطالعات اپيدميولوژيكي، ذرات معلق در مقايسه با اكسيدهاي گوگرد و اكسيدهاي ازت براي سلامت انسان مخاطره آميزتر است و مقدار PM10 در تشديد بيماري هاي قلبي – ريوي، كاهش مقاومت سيستم ايمني بدن در مقابل بيماري ها، از بين رفتن بافت ريه، آسم كودكان، مرگ ومير زودرس و سرطان نقش عمده اي دارد. بكر و همكاران (2002)، نشان دادند ذرات آلودگي هوا موجب تحريك
TLR2 و TLR4 و توليد سايتوكاين هاي پيش التهابي مي شود (6). يكي از اجزاي ذرات معلق كه اهميت بسياري دارد، كربن سياه است. كربن سياه ناشي از احتراق ناقص هيدروكربن هاي مايع و گازي است وامروزه به دليل استفاده در سوخت گازوئيل و موتورهاي ديزلي، از آن به عنوان آلايندة موتورهاي ديزلي ياد مي شود. مطالعات نشان داده اند كه بين قرارگيري در معرض ذرات كربن سياه و التهاب و خطر برخيبيماري ها رابطه وجود دارد (45). جكسون و همكاران (2012) در تحقيق روي موش هاي باردار نشان دادند كه قرارگيري در معرض ذرات كربن سياه با افزايش التهاب و آسيب DNA همراه است (31). در همين زمينه، بوردن و همكاران نيز در تحقيقي روي موش ها نشان دادند كه قرار دادن موش در معرض كربن سياه (162/0 ميلي گرم) به التهاب ريه و مايع پوشانندة ريه و نيز در كبد منجر مي شود (20).
افزايش استفاده از كربن سياه در سوخت هاي ديزلي، صنعت تاير ماشين، پلاستيك و موارد ديگر نگراني هاي روزافزوني را در اين زمينه موجب شده است. انجام تمرينات ورزشي در هواي آلوده با چالش هاي بسياري روبه روست و پژوهش هاي كمي به صورت عمقي به آن پرداخته اند (41). پاره اي پژوهش ها تمرينات ورزشي در هواي آلوده را مضر دانسته اند (39، 38، 37، 30، 23، 9)، اين در حالي است كه پژوهش هاي ديگر آن را رويكرد مناسبي براي تعديل تأثيرات مضر آلودگي هوا قلمداد كرده اند (34، 28، 19). تمرينات هوازي منظم، فوايد سلامتي بسياري را در پي دارد كه از جمله مي توان بهبود آمادگي قلبي- عروقي (28)، بهبود كيفيت زندگي، كاهش چاقي و فشار خون و افزايش طول عمر را نام برد. انجام تمرينات هوازي به صورت منظم و مداوم استرس اكسايشي را به صورت سيستماتيك (19) در بيماري هاي مختلف مانند بيماري هاي قلبي، ديابت نوع -2، آرتريت روماتوئيد، آلزايمر و پاركينسون (33) و در سلول هاي اپي تليال مسيرهاي هوايي حيوانات داراي آلرژي طولاني مدت و التهاب ريه كاهش مي دهد (42). علاوه بر آن، تمرينات منظم تأثيرات ضد التهابي در انواع مختلف بيماري هاي ريوي مانند آسم (29)، سندروم زجر تنفسي حاد (27) و بيماري هاي انسداد ريوي مزمن (24) به همراه دارد .
مطالعات انجام گرفته در زمينة بررسي تأثير قرارگيري در معرض آلودگي هوا به هنگام تمرينات ورزشي پيشنهاد كرده اند افرادي كه در هواي آلوده ورزش مي كنند، در معرض افزايش خطر بيماري هاي تنفسي و قلبي-عروقي قرار دارند، زيرا تمرينات ورزشي ميزان تنفس و تبادلات ريوي و تنفس آلاينده هاي سمي را افزايش مي دهد (38، 37، 30، 23، 9). تهوية دقيقه اي در حالت استراحت حدود 6 ليتر بوده و اين در حالي است كه در فعاليت متوسط ميزان آن 12 است و در فعاليت شديد تا 27 برابر افزايش مي يابد (46). از طرف ديگر، سطح تماس بين ذرات آلودگي هوا و مسيرهاي تنفسي وسيع است و اين مسئله مي تواند مسيرهاي تنفسي و ريه ها را بيشتر آسيب پذير كند (12). تمرينات ورزشي مي تواند به وسيلة افزايش دوز تحويل آلاينده ها به ريه در نتيجة افزايش تهوية ناشي از تقاضاي متابوليك، تأثيرات معكوسو مضري را ايجاد كند (13). با وجود اين، اين مطالعات، سازوكارهاي اثر تمرينات هوازي را كه م يتواندعوامل پيش التهابي ناشي از آلودگي هوا را تعديل كند، به صورت عمقي و در سطح گيرنده و مولكوليبررسي نكرده اند يا تعداد اين مطالعات نيز بسيار اندك است. بنابراين اين سؤال پيش مي آيد كه آيا انجام شش هفته تمرينات هوازي ميتواند بيان گيرندة شبه تول – 4 و فاكتور نكروزدهندة تومور را در رية موش هاي در معرض هواي آلوده به ذرات كربن سياه با قطر كمتر از 10 ميكرون (PM10) تغيير دهد؟ بنابراين، هدف از مطالعة حاضر بررسي تأثير شش هفته تمرين هوازي در هواي آلوده به ذرات كربن سياه با قطر كمتر از 10 ميكرون بر روي بيان TLR4 و TNF-α در بافت ريه موش هايي صحرايي نر بود.

روش شناسي حيوانات و شرايط نگهداري
24 سر موش نر نژاد ويستار 10 هفته اي از مؤسسة پاستور خريداري شدند. حيوانات در گروه هاي سه تايي در قفس هاي مخصوص در دماي اتاق (6/3± 22 درجة سانتي گراد) و طبق چرخة 12 ساعت خواب و بيداري و با دسترسي آزاد به آب و غذا نگهداري شدند. تمام آزما يشهاي صورت گرفته براساس دستورالعمل كار با حيوانات دانشگاه تربيت مدرس انجام گرفت. موش ها پس از 14 روز نگهداري و يك هفته آشنايي با تردميل و پروتكل تمريني به صورت تصادفي به چهار گروه؛ الف) كنترل 1 (بدون تمرين و بدون قرار گرفتن در معرض هواي آلوده به ذرات كربن سياه)، ب) كنترل 2 (بدون تمرين و با قرار گرفتن در معرض هواي آلوده به ذرات كربن سياه)، ج) تمرين (تمرين هوازي و بدون قرار گرفتن در معرض هواي آلوده به ذرات كربن سياه)، د) آلودگي+ تمرين 3 (تمرين هوازي همراه با قرار گرفتن در معرض هواي آلوده به ذرات كربن سياه) تقسيم شدند.
پروتكل قرارگيري در معرض ذرات
به منظور اجراي پروتكل تزريق ذرات از دستگاه و اتاقك (فالونك)3 استفاده شد. دستگاه تزريق و اتاقك به گونه اي بود كه هر يك دقيقه يك بار هواي اتاقك عوض ميشد و با ايجاد فشار منفي در اتاقك از خروج ذرات به فضاي آزمايشگاه جلوگيري به عمل ميآمد. ذرات آلاينده با غلظت حدود 5 ميليگرم درمتر مكعب، دماي 22 درجة سانتي گراد و رطوبت1 29 درصد شبيه سازي مي شد. موش هاي گروه “ب ود” به مدت دو ساعت در روز ، 5 روز در هفته و به مدت 6 هفته در معرض هواي آلوده به ذرات كربنسياه قرار گرفتند. ذرة آلايندة به كاررفته در اين تحقيق كربن سياه (N660) با قطر كمتر از 10 ميكرون بود كه از شركت دودة كربن ايران تهيه شد. شكل و قطر ذرات به ترتيب با روش تصويربرداري استفاده از ميكروسكوپ نوري2 و داست كانتر 3 بررسي و تأييد شد.
پروتكل تمريني
ابتدا در مرحلة آشناسازي، موش ها 3 روز در هفته، 15 دقيقه در روز و با سرعت 20 متر بر دقيقه به مدت يك هفته تمرين كردند. پس از آن، براي تعيين بار كار بيشينة حيوانات، آزموني فزاينده به قرار زير انجام گرفت:
آزمون با سرعت 6 متر بر دقيقه شروع و هر 3 دقيقه 3 متر بر دقيقه بر سرعت دستگاه افزوده مي شد تا حيوان قادر به دويدن نباشد (سه بار جا ماندن و افتادن از سرعت تردميل) و بار كار بيشينه براي هر موش مشخص شد. از ميانگين بار كار بيشينة هر گروه براي تعيين شدت تمرين گروه استفاده شد. برنامة تمرين اصلي با گرم كردن 10 دقيقه اي با سرعت 6 متر بر دقيقه شروع و سپس تمرين اصلي با ويژگي هاي زير اجرا شد: »دويدن با 50 درصد بار كار بيشينه هر گروه، 60 دقيقه در روز، 5 روز در هفته و به مدت 4 هفته«.
آماده سازي بافت
موش هاي صحرايي 24 ساعت پس از آخرين جلسة تمرين و قرارگيري در معرض ذرات آلودگي با تركيبي از كتامين (30 تا 50 ميلي گرم در كيلوگرم به صورت زير صفاقي) و زايلازين (3-5 ميلي گرم در كيلوگرم) بي هوش شدند. بافت ريه بلافاصله جدا و در مايع نيتروژن منجمد شد. نمونه هاي بافتي تا زمان اندازه گيري در فريزر 80- درجة سانتي گراد نگهداري شدند.
استخراج RNA و سنتز cDNA
حدود 50 ميلي گرم بافت ريه به صورت جداگانه، جهت استخراج total RNA به نسبت 1 به 10 در
1. بادسنج هات واير ديتا لاگر مدل TES-1341 ساخت تايوان
.Acc.V- Spot magn. 25.0 KV 3.4. 5000x.
. Grimm Aerosol Technique GmbH & Co. KG .Dorfstraße 9 – 83404 Ainring (Germany)
QIAzol Lysis Reagent هموژن شد. به منظور برداشتن اجزاي پروتئيني، محصول حاصل درC0 4،g ،10min12000 سانتريفيوژ شد. سپس به نسبت 1 به 5/0 با كلروفرم مخلوط و به مدت 15 ثانيهبه شدت تكان داده شد. محصول در g ،15min ،4 0C12000 سانتريفيوژ و بخش معدني و آبي از همجدا شدند، بخش محتوي RNA برداشته و با نسبت 1 به 5/0 با ايزوپروپانول مخلوط و به مدت 10 دقيقه در دماي اتاق رها و سپس درg ،10min ،4 0C12000 سانتريفيوژ شد. Pellet حاوي RNA در اتانول شستوشو و در Lµ20 آب RNAS-Free حل گرديد. غلظت RNA مورد سنجش واقع شد (Eppendorff, Germany) و نسبت 260 به 280 بين 8/1 تا 2 به عنوان تخليص مطلوب تعريف شد.
Reverse و آنزيم Random hexamer primer و با استفاده از RNA از gµ1 با استفاده از cDNA سنتز
.انجام گرفت transcriptase
Real time – PCR
به منظور اندازه گيري سطوح بيان از روش كمي Real time-PCR با استفاده از Primix syber green II انجام گرفت (Applied Biosystems, USA). مخلوط واكنش در حجم نهايي Lµ20 و هر واكنش به صورت duplicate صورت پذيرفت. طراحي پرايمرها براساس اطلاعات ژن هاي TLR4 و TNF-α و GAPDH در بانك ژني NBCI و توسط شركت ماكرو ژن (Macrogen Inc, Seoul, Korea) انجام گرفت. توالي پرايمرهاي مورد استفاده در جدول 1 گزارش شده است، ضمن اينكه از GAPDH بهعنوان ژن كنترل استفاده شد. برنامة دمايي مورد استفاده در Real time-PCR شامل: 95 به مدت 10 دقيقه- 95 به مدت 15 ثانيه، 60 به مدت 1 دقيقه (تكرار 40 سيكل) بود. ميزان بيان ژن هاي مورد نظر نيز با روش
CT∆∆-2 اندازه گيري شد.
جدول 1. توالي پرايمرهاي مورد استفاده در پژوهش حاضر
Genes Primer sequence
TLR4
For: 5′- AATCCCTGCATAGAGGTACTTCCTAAT -3′ Rev: 5′- CTCAGATCTAGGTTCTTGGTTGAATAAG -3′
TNF-α For: 5′- GACCCTCACACTCAGATCATCTTC -3′ Rev: 5′- TGCTACGACGTGGGCTACG -3′
GAPDH For: 5′- GACATGCCGCCTGGAGAAAC -3′ Rev: 5′- AGCCCAGGATGCCCTTTAGT -3′

تجزيه وتحليل آماري
تمامي داده ها براساس ميانگين±انحراف استاندارد توصيف شده اند. از آزمون تحليل واري انس يكطرفه پساز تحليل نمره هاي پس آزمون از پيش آزمون براي بررسي وجود تفاوت معنادار وزن بدن موش ها اسـتفادهشد. براي تعيين نرمال بودن توزيع داده ها از آزمون كولموگروف اسميرنوف و بـه منظـور تعيـين معنـاداربودن تفاوت بي ن گروه ها از تحليل واريانس (ANOVA) چندسويه و آزمون تعقيبي LSD و نيز آزمون ناپارامتريك فريدمن استفاده شد. سطح معناداري نيز 05/0≤P در نظر گرفته شـد . كليـة بررسـي هـاي آماري با استفاده از نرم افزار SPSS نسخة 20 انجام گرفت.
يافته ها
تمام حيوانات در گروه هاي تمريني و آلودگي توانستند چهار هفته تمرين هوازي و قرارگيري در معـرضذرات كربن سياه كمتر از 10 ميكرون را به طور مداوم انجام دهند و به اتمام برسانند. اختلاف معنـاداري در تودة بدن گروه ها، پس از مداخله مشاهده نشد (334/0=P=0/937) (F). با وجود اين تمرين در هواي آلوده به ذرات كربن سياه كاهش وزن بدن موش ها منجر شد (جدول 2).

جدول 2. تودة بدن حيوانات گروه هاي تحقيق پس از مداخله بر حسب گرم ميانگين±انحراف معيار (گرم)

فرايند

گروه

فرايند

گروه

311/17±36/66 كنترل
324/33±27/12 آلودگي
304/33±43/31 تمرين
315/67±33/23 آلودگي+تمرين

با توجه به طبيعي بودن توزيع داده هاي P=0/498) TNF-α)، از آزمون تحليـل واريـانس چندسـويههمراه با تست تعقيبي LSD استفاده شد. نتايج آناليز واريانس چندسويه تفـاوت معنـاداري را تنهـا بـين گروه تمرين و آلودگي در مقدار P=0/047) TNF-α) نشان داد. در مورد ساير گروه هاي مورد بررسـي درمقدار TNF-α تفاوت معناداري مشاهده نشد. با وجود اين بيان TNF-α در گروه آلودگي + تمرين كمتـراز گروه آلودگي و بيشتر از گروه تمرين و كنترل بود. گـروه تمـرين همچنـين بيـانTNF-α كمتـري رانسبت به گروه كنترل داشت (نمودار 1).

نمودار
1
.

ميانگينار
زش

هاي

TNF-
α

درگروه

هاي

مورد

مطالعه



قیمت: تومان

برای دانلود متن کامل پایان نامه ها اینجا کلیک کنید


دیدگاهتان را بنویسید